[an error occurred while processing this directive]
Provide DNA (see below) The core can provide some primers, or you can add your own. But the maximum volume of your DNA sample can only be 11.4ul, 12uL if the sequencing primer has been added.
| Plasmids | Provide 0.2-0.5ug of DNA for each reaction. This DNA must be in water at final volume of 10.4ul. If you have a special primer add 1.6ul of a 2uM solution to the tube. Final volume must not exceed 12 ul for DNA plus primer, and it must be in water. |
| PCR Products | 50ng per reaction. Primer as above. Again do not exceed 12 ul total. |
| Primers | We can supply some standard primers (see list below) |
NOTE: We have found the BioRad Mini Kits to be very reliable. Qiagen and Wizard kits also work.
Submit a Request Form by downloading, printing, and filling in the form (pdf). Please write clearly and make sure you indicate whether the primer is added or not! To get the pdf file you will need Adobe Acrobat Reader.
Bring samples and completed forms to Room 507, A Building, HSC (319 Abraham Flexner Way). Give to Ron Gregg or Greg Willer.
Sequences will usually be completed within 48 hours (we try for even sooner). Sequence files will be forwarded to you by e-mail. In general we will forward ".scf" files. These contain the image data so you can look at the quality of the sequence. All sequence handling programs can read these files. We use DNAStar. But GCG, Sequencher etc will work. If you don't have one of these we urge you to get a program that can. There is a program called CHROMAS, that reads these files, allows you to edit etc., and it is shareware (Windows 95/NT).
| GL1 | TGTATCTTATGGTACTGTAACTG |
| GL2 | CTTTATGTTTTTGGCGTCTTCCA |
| RV 3 | CTAGCAAAATAGGCTGTCCC |
| RV4 | GACGATAGTCATGCCCCGCG |
| T3 | CAATTAACCCTCACTAAAGG |
| T7 | GTAATACGACTCACTATA |
| M13 Forward (-20) | GTAAAACGACGGCCAG |